Information

Wo befindet sich die Knorpelplatte in dieser elektronenmikroskopischen Aufnahme der Luftröhre?


Wie konntest du es auch sagen? Angenommen, Ihnen wurde nur ein Foto des Knorpels gezeigt, wie würden Sie es identifizieren?


Quantitative photogrammetrische Analyse und qualitative stereoskopische Analyse von REM-Bildern

Dieser Artikel befasst sich mit Methoden zur Gewinnung dreidimensionaler (3D) Informationen aus Rasterelektronenmikroskop(REM)-Bildern. Es mag überraschen, dass dieses Thema eine gesonderte Diskussion verdient, da allgemein anerkannt ist, dass jedes SEM-Bild einer rauen Oberfläche unter Verwendung des Sekundärelektronenemissionsmodus scheinbare 3D-Informationen liefert. Dies trifft in gewissem Maße zu, da REM-Bilder mit Fotografien von rauen Oberflächen vergleichbar sind, die mit Licht aus einer Richtung beleuchtet werden, aber unser Hauptaugenmerk liegt hier auf der 3D-Visualisierung aus stereoskopischen Bildpaaren. Es gibt jedoch auch im SEM andere Möglichkeiten, 3D-Informationen zu erhalten, und diese werden zuerst betrachtet. Der Rest des Artikels befasst sich hauptsächlich mit der Verwendung von stereoskopischen Parallaxen, unabhängig davon, ob sie als solche visualisiert werden oder nicht. Üblicherweise verwendete Verfahren zum Betrachten von Stereopaaren werden beschrieben, gefolgt von einfachen Verfahren zum Messen von stereoskopischen Parallaxen. Formeln zur Reduzierung der Längenmaße in den beiden Fotografien auf reale Höhenunterschiede werden angegeben.


Embryologie und Histologie der Lunge

Diese Präsentation dient dem Verständnis der Lungenentwicklung und Histologie.

Verwandte Bücher

Kostenlos mit einer 30-Tage-Testversion von Scribd

Verwandte Hörbücher

Kostenlos mit einer 30-Tage-Testversion von Scribd

Bronchien und Bronchiolen sind im Allgemeinen mit Blutgefäßen verbunden, die der gleichen verzweigten Baumstruktur folgen. Beachten Sie die Arterien, einschließlich der kleineren Arterie links von der beschrifteten, und auch die Arteriole, die unten rechts unterhalb der Bronchiole verläuft. Denken Sie daran, dass die dünnen Wände, die die Alveolen trennen, ein Netzwerk von Kapillaren umfassen.

Blut wurde in Blutgefäßen zurückgehalten, so dass das auffällige Vorhandensein von roten Blutkörperchen dazu dient, die Lage der Alveolarkapillaren zu erkennen.

Jede Alveolarwand hat ein einfaches Plattenepithel, das jede freiliegende Oberfläche auskleidet, mit einem dünnen Stroma aus Kapillaren und einem empfindlichen Bindegewebe, das dazwischen liegt. Diese Details können in diesem Bild nicht eindeutig aufgelöst werden.
Flache Kerne in der Alveolarwand repräsentieren entweder Typ-I-Pneumozyten (Plattenepithelzellen) oder kapillares Endothel. Runde Kerne können Typ-II-Pneumozyten (Tensid-sekretierende große Alveolarzellen) darstellen.
Monozyten aus zirkulierendem Blut können aus den Alveolarkapillaren kriechen, das Alveolarepithel durchqueren und in den Alveolarluftraum gelangen.


ERGEBNISSE

Herstellung transgener Mäuse

Eine Linie transgener Mäuse mit einem gezielten Allel für Spalte11a2 (Liu et al., 1996) wurde durch homologe Rekombination in ES-Zellen unter Verwendung eines Konstrukts hergestellt, das die Introns 8 bis 41 der umfasste Spalte11a2 Gen (Abb. 1). Das Neomycin-Gen (Neo) wurde vom Phosphoglyceratkinase-Promotor in umgekehrter Orientierung zwischen zwei Restriktionsstellen in Exon 27 und 28 eingefügt, so dass es Sequenzen aus den beiden Exons verband. Heterozygote Mäuse für das Null-Allel wurden gezüchtet, um homozygote Mäuse zu erzeugen, wie durch Southern-Blot-Analyse gezeigt ( 2A ). Northern-Blot-Analyse von mRNA aus Chondrozyten, die aus dem Xiphoid-Knorpel von homozygoten Mäusen isoliert wurden, zeigte das Fehlen von mRNA voller Länge für Spalte11a2 (Abb. 2B). Jedoch hybridisierten mindestens zwei kurze RNA-Transkripte von 4,2 kb und 3,8 kb mit einer Sonde, die die Sequenzen von Exon 62 bis Exon 65 des . enthielt Spalte11a2 Gen. Die Transkription kann daher über das erfundene erfolgen Neo, aber die mRNA ist instabil, wahrscheinlich aufgrund des Einschlusses der invertierten Neo Sequenz innerhalb der Transkripte (Culbertson, 1999). Reverse Transkriptase-Polymerase-Kettenreaktion (RT-PCR) wurde mit Gesamt-RNA aus dem femoralen Epiphysenknorpel durchgeführt, wobei der Vorwärtsprimer auf Exon 23 und der Rückwärtsprimer auf Exon 29 gerichtet war. Vier Banden mit einer Größe von 1,0 kb bis 1,4 kb , wurden eher nach PCR als eine einzelne Bande mit einer erwarteten Größe von ungefähr 1,5 kb erhalten. Alle vier Banden wurden kloniert und vollständig sequenziert. Die Ergebnisse zeigten, dass das 3'-Ende von Exon 26 konsistent an dieselbe A/B-Grenze gespleißt war, die 71 bp stromabwärts vom 3'-Ende des Neomycin-resistenten Gens (in Fig. 3 mit A bezeichnet) lag. Es wurde jedoch gefunden, dass drei der vier Transkripte einem zusätzlichen internen Spleißen von Sequenzen innerhalb des invertierten Neomycin-resistenten Gens (bezeichnet als H2, H3 und H4 Fig. 3) unterzogen wurden. Alle Spleißereignisse wurden zwischen GT/AG-Konsensus-Dinukleotiden lokalisiert. Alle vier Transkripte enthielten vorzeitige Terminationscodons in allen drei Frames entweder in der mit G bezeichneten Sequenz oder in der stromabwärts gelegenen Polylinkersequenz. Daher kann die Übersetzung nicht über das Invertierte hinausgehen Neo Einfügung. Wir haben keine Beweise dafür gefunden, dass die Neo Sequenz könnte vollständig aus den Transkripten oder für andere Spleißereignisse gespleißt werden, wie zuvor für . beschrieben Neo Sequenzen (Forsberg et al., 1996).

Schema der relevanten Region der Spalte11a2 Gen, der Targeting-Vektor und die Mutante Spalte11a2 Gen nach homologe Rekombination. Das genomische Fragment für den Targeting-Vektor erstreckte sich über Intron 8 bis Intron 41. TK, Herpes-simplex-Thymidinkinase-Gen Neo, Neomycin-resistentes Gen E, X und B, Restriktionsstellen für ÖkoRI, XhoLand BamHI.

EIN: Southern-Blot-Analyse zur Identifizierung heterozygoter und homozygoter transgener Mäuse. Die Sonde war ein ÖkoRI-Fragment, das Intron 41 bis Intron 49 überspannte (siehe Fig. 1 und Text). B: Northern-Blot-Analyse von Knorpel-RNA von Wildtyp- und homozygoten Mäusen. Xiphoidknorpel wurde von Mäusen seziert und Chondrozyten wurden durch enzymatischen Abbau von Gewebe gewonnen. Gesamt-RNA wurde extrahiert und durch Northern-Blot-Analyse unter Verwendung von a . analysiert HindIII/BamHI-cDNA-Fragment, das für die Exons 62 bis 65 kodiert.

Schematische Darstellung der Ergebnisse, die durch Reverse-Transkriptase-Polymerase-Kettenreaktion auf Knorpel-mRNA von homozygoten Mäusen unter Verwendung von Primern erhalten wurden, die sich in den Exons 23 und 29 befinden. Vier Banden wurden von 1,0 bis 1,4 kb nachgewiesen und alle diese Banden wurden subkloniert und sequenziert. In allen Col11a2-Transkripten der homozygoten Mäuse wurde festgestellt, dass das 3′-Ende von Exon 26 ungefähr 71 Nukleotide stromabwärts des 3′-Endes des invertierten Neomycin-resistenten Gens (bezeichnet als H1–H4) an eine Akzeptorstelle gespleißt ist. . In drei der Transkripte gab es auch internes Spleißen von kodierenden Sequenzen des invertierten Neomycin-resistenten Gens (H2, H3 und H4).

Um zu bestätigen, dass die Spalte11a2 Allel wurde inaktiviert, Rippenknorpel wurde von 1 Monat alten Wildtyp- und homozygoten transgenen Mäusen seziert, das Gewebe wurde mit Pepsin verdaut und die kollagenen Komponenten wurden durch Natriumdodecylsulfat-Polyacrylamid-Gelelektrophorese (SDS-PAGE) auf das Vorhandensein von . untersucht Kollagen Typ XI. Wie in Fig. 4, Spur B, gezeigt, war die α1(XI)- oder α1(V)-Kette von Typ V/XI-Kollagen noch vorhanden. Die α2(XI)-Kette fehlte jedoch. Die α3(XI)-Kette wurde nicht von der reichlich vorhandenen α1(II)-Kette getrennt, die in normalen Mengen synthetisiert zu sein schien.

Natriumdodecylsulfat-Polyacrylamid-Gelelektrophorese von Pepsin-resistentem Kollagen aus dem Rippenknorpel eines 1 Monat alten Wildtyps (links) und homozygote Mäuse (rechts). Gleiche Probenmengen wurden auf das Gel aufgetragen. Die Proteinbanden wurden durch Coomassie-Blau-Färbung sichtbar gemacht, um α-Ketten von Typ-II- und Typ-XI-Kollagenen zu identifizieren. Eine Bande der α2(XI)-Kette kann im homozygoten Rippenextrakt nicht nachgewiesen werden.

Phänotyp der Mäuse

Heterozygote Mäuse waren bei der Geburt nicht von normalen Wurfgeschwistern zu unterscheiden. Homozygote Mäuse waren ungefähr 25 % kleiner als normale Wurfgeschwister (8,51 g ± 1,87 SD [n = 14] vs. 11,1 g ± 0,85 SD [n = 6] P = 0,005). Homozygote Mäuse waren auch von Kontroll- und heterozygoten Wurfgeschwistern dadurch erkennbar, dass sie eine kürzere Schnauze und eine leicht vorgewölbte Stirn hatten (Fig. 5A). Sie waren bis zum Alter von 2 Jahren weiterhin von etwas kleinerer Körpergröße und konnten leicht an ihrem dreieckigen Gesicht identifiziert werden. Diese Unterscheidungsmerkmale waren am deutlichsten in gefärbten Skeletten (Abb. 5B). Jedoch hatte keine von über 200 neugeborenen homozygoten Mäusen, die untersucht wurden, eine Gaumenspalte, wie sie üblicherweise bei OSMED-Patienten beobachtet wird (Melkoniemi et al., 2000). Bei der Untersuchung im Alter von 4 Monaten reagierten homozygote Mäuse nicht auf laute Geräusche, eine Beobachtung, die darauf hindeutet, dass sie eine Hörschwäche hatten. Anschließend bestätigten Klick-evozierte auditive Hirnstammreaktionstests dies, und die strukturelle Grundlage des Mangels schien von den desorganisierten Kollagenfibrillen der Tektorialmembran zu stammen (McGuirt et al., 1999). Es gab keine offensichtlichen groben Anomalien des Auges oder anderer wichtiger Organe.

EIN: Fotos von normalen und homozygoten Mäusen, um die Gesichtsunterschiede zu zeigen. B: Gefärbte Skelette von neugeborenen Wildtyp (+/+), heterozygoten (+/-) und homozygoten Mäusen (-/-). Beachten Sie die Gesichtsunterschiede bei der homozygoten Maus. C: Aussehen der Schädel von Wildtyp- und homozygoten Mäusen. Beachten Sie die steilere Neigung des Schädels und die Vertiefungen in den Nasenknochen (Pfeil) bei der homozygoten Maus. D: Vergleich der Länge-zu-Breite-Verhältnisse von Knochen an den dorsalen Aspekten von Schädeln von 1 Jahr alten Wildtyp (+/+) und homozygoten (-/-) Mäusen. Jeder Datenpunkt repräsentiert den Durchschnitt ± SEM von sieben Schädeln. Knochen sind von posterior (INT) nach anterior (NAS) angeordnet. Der Unterschied im Verhältnis für das Nasenbein ist signifikant bei P ≤ 0,001 und ergibt sich aus der kürzeren Knochenlänge im homozygoten Schädel. INT, interparietaler Knochen PAR, parietaler Knochen FRO, Stirnbein PRE, Prämaxillae NAS, Nasenbein.

Kraniofaziale Morphologie

Eine grobe anatomische Untersuchung von Schädeln von 1-jährigen Mäusen zeigte, dass die Nasenknochen der homozygoten Mäuse stärker geneigt waren und ihre medialen Oberflächen oft eingedrückt waren (Fig. 5C Pfeil). So erzeugten in situ die beiden angrenzenden Nasenbeine eine merkliche Vertiefung. Die Verhältnisse von Länge zu Breite des Nasenknochens von homozygoten Mäusen zeigten einen signifikanten Unterschied im Vergleich zum Wildtyp, aber andere Schädelknochen (interparietale, parietale, frontale und prämaxilläre Knochen) waren nicht signifikant betroffen ( 5D ).

In koronalen Schnitten des Schädels von 1-jährigen Mäusen war der Unterschied in Einbuchtung und Form der Nasenknochen deutlich erkennbar (Abb. 6A,C). In koronalen Schnitten homozygoter Neugeborener (Fig. 6D) waren die Nasenknochen tief in Richtung des Y-förmigen Knorpels, der aus der sich entwickelnden Nasenscheidewand entstand, eingefallen, insbesondere im Vergleich zu Schnitten von Wildtyp-Mäusen (Fig. 6B). Das Nasenbein entwickelt sich durch intramembranöse Verknöcherung, seine Form wird jedoch durch den angrenzenden Knorpel bestimmt (Abb. 6B,D). Die Unterschiede in Länge, Neigung und Vertiefung des Nasenbeins bei homozygoten Mäusen können daher durch Unterschiede in der Form des Knorpels erklärt werden, der als Vorlage für die Bildung des Nasenbeins dient (Abb. 6B, D).

A, C: Koronaler Schnitt des vorderen Schädels von Wildtyp- und homozygoten Mäusen im Alter von 1 Jahr. Bei der homozygoten Maus ist eine ausgeprägte Vertiefung der beiden Nasenknochen (N) erkennbar, während der Prämaxillaknochen (P) unbeeinflusst erscheint. B, D: Entwicklung der Nasenbeine (N) bei neonatalen Mäusen, bei denen der Septumknorpel (S) als Matrize fungiert. Beachten Sie, dass die Nasenknochen bei der homozygoten Maus nach unten ragen. NA, Nasenhöhle.

Morphologie langer Knochen

In Paraffin eingebettete Schnitte von Kniegelenken von Wildtyp- und homozygoten Mäusen wurden 1 Monat nach der Geburt hergestellt. Die Untersuchung dieser Schnitte zeigte eine stark desorganisierte Wachstumsfuge im Homozygoten, wobei sich die Chondrozyten nicht in Spalten ausrichten konnten (Fig. 7B, D). Ähnliche Ergebnisse wurden für alle anderen untersuchten Wachstumsplatten gefunden. Im Wildtyp waren die Wachstumsplatten gut organisiert, wobei Chondrozyten in Längsspalten ausgerichtet waren, so dass einzelne Ruhe-, Proliferations- und hypertrophe Zonen leicht erkannt werden konnten ( 7A , C). Im Gegensatz dazu erschien die Wachstumsplatte von homozygoten Mäusen ohne α2(XI) völlig desorganisiert und bei näherer Betrachtung erschienen die Kerne einiger Chondrozyten pyknotisch. Hypertrophe Chondrozyten konnten jedoch oft direkt unterhalb der proliferierenden Schicht beobachtet werden, was darauf hindeutet, dass die terminale Differenzierung der Chondrozyten normal ablaufen konnte. Der tibiale Gelenkknorpel war im Durchschnitt dünner als beim Wildtyp (vgl. Abb. 7E,F). Das gleiche wurde für alle Gelenkknorpel im Alter von 1 Monat beobachtet (siehe Abb. 9). Außerdem waren Chondrozyten des Gelenkknorpels der homozygoten Mäuse zufälliger organisiert (vergleiche Fig. 7E und 7F). Die Transmissionselektronenmikroskopie der Wachstumsplatte zeigte das Vorhandensein von feinen Kollagenfasern, die oft zwischen den Zellsäulen sowohl bei Wildtyp- als auch bei homozygoten transgenen Mäusen ausgerichtet waren ( 8A , B). Die Kollagenfibrillen der homozygoten Maus erschienen oft weniger organisiert in lateralen Anordnungen als in der Wildtyp-Maus, wie zuvor in der Tektorialmembran beobachtet (McGuirt et al., 1999). In einigen Bereichen der proliferativen Zone wurden die Fibrillen eng miteinander verbunden und bildeten elektronendichte Bündel (Fig. 8C). Die Bildung großer Aggregate von fibrillärem Kollagen, wie für die cho/cho Maus trat nicht auf (Li et al., 1995).

Histologische Analyse von 1 Monat alten postpartalen Tibiaepiphysen vom Wildtyp (AS) und homozygote Mäuse (B, D, F). Bei der Wildtyp-Maus (+/+) enthält die gut organisierte Wachstumsplatte ruhende, proliferierende und hypertrophe Schichten. Bei der homozygoten (-/-) Maus richten sich die Chondrozytensäulen nicht richtig aus und die Zellen erscheinen desorganisiert und bilden oft zufällige Cluster. E und F: Beachten Sie die unterschiedliche Organisation der Chondrozyten im Gelenkknorpel. Der Wildtyp bildet eine gut organisierte Matrix, während beim homozygoten Tier der Gelenkknorpel dünner ist und die Zellen leicht desorganisiert erscheinen. Maßstabsbalken = 125 µm in B (gilt für A,B), 50 µm in D (gilt für C,D), 25 µm in E (gilt für E,F).

Transmissionselektronenmikroskopie der femoralen Wachstumsfuge (1 Monat postpartum) eines Wildtyps (+/+) (EIN) und homozygote (-/-) transgene Maus (B, C). A und B zeigen vergleichbare Regionen, die sich in der proliferativen Zone der Wachstumsplatte zwischen zwei Chondrozytensäulen befinden. Beachten Sie die parallele Ausrichtung der Fibrillen in A und der etwas weniger geordneten Fibrillen in B. C ist ein repräsentativer Bereich der proliferativen Zone, in der die Chondrozyten stark desorganisiert sind. Beachten Sie, dass die Fibrillen seitlich oft eng verbunden sind, um elektronendichte Bündel zu bilden. Maßstabsbalken = 500 nm

Wir untersuchten zusätzlich Schnitte der Oberschenkelknochen von Mäusen nach 15,5 Tagen, 17,5 Tagen, Neugeborenen und 1 Woche, 2 Wochen und 4 Wochen nach der Geburt. Vor der Bildung einer ausgeprägten Wachstumsplatte ordnen sich die Chondrozyten nicht in Säulen an und waren beim Vergleich von Wildtyp und Homozygoten nicht merklich desorganisiert. 1, 2 und 4 Wochen nach der Geburt wurde jedoch die fehlende Organisation der Chondrozyten deutlicher erkennbar und war am deutlichsten, nachdem sich die Wachstumsfuge nach 4 Wochen vollständig gebildet hatte (Ergebnisse nicht dargestellt). Innerhalb einer Extremität zeigten alle Wachstumsfugen eine ähnliche Desorganisation bei den Homozygoten. Daher scheint es, dass die α2(XI)-Kette für die korrekte Organisation der Kollagenfibrillen jeder Wachstumsplatte erforderlich ist, aber möglicherweise in frühen Stadien der Chondrogenese keine kritische Rolle spielt.

Um die Differenzierung von Chondrozyten zu evaluieren, führten wir eine In-situ-Hybridisierung an der neonatalen Tibia für Spalte1a1, Spalte2a1, Spalte10a1, Spalte 11a1, und Spalte5a1. Alle untersuchten Sonden für diese Kollagengene zeigten die gleichen Expressionsmuster in der Tibia von Wildtyp- oder homozygoten Mäusen, wobei die α1(V)-Kollagenkette im sich entwickelnden Knochen und Knochenkragen und nicht im Knorpel exprimiert wurde (Abb. 9H, J). Kollagen vom Typ X wurde nur im hypertrophen Knorpel exprimiert (Fig. 9C, F). Zusätzlich führten wir eine immunhistochemische Färbung mit Antikörpern gegen Kollagen Typ II und Kollagen Typ X durch. Kollagen vom Typ II wurde in der gesamten knorpeligen Region der Wachstumsplatte nachgewiesen, aber Kollagen vom Typ X wurde nur in der hypertrophen Schicht sowohl bei Wildtyp- als auch bei homozygoten Mäusen nachgewiesen (Daten nicht dargestellt). Obwohl die Wachstumsfuge deutlich desorganisiert ist, entwickeln sich die Chondrozyten dennoch zur Hypertrophie.

In-situ-Hybridisierung mehrerer Kollagen-mRNAs in der tibialen Wachstumsplatte. Spalte1a1 (ANZEIGE) und Spalte5a1 (H, J) werden nur im Knochenkragen und im sich entwickelnden Knochen nachgewiesen. Spalte2a1 (SEIN) und Spalte 11a1 (G, ich) werden sowohl in den ruhenden als auch in den proliferierenden Schichten des sich entwickelnden Knorpels nachgewiesen, jedoch nicht im hypertrophen Knorpel. Spalte10a1 (C,F) wird nur in den hypertrophen Chondrozyten nachgewiesen. Für die fünf Kollagen-mRNAs konnte sowohl bei Wildtyp- als auch bei homozygoten Mäusen kein Unterschied in den Expressionsmustern festgestellt werden. Maßstabsbalken = 250 μm in F (gilt für A–F), in J (gilt für G–J).

Gelenkknorpel

Wir haben die Dicke der Epiphysen von mehreren Röhrenknochen gemessen, da erste Beobachtungen darauf hindeuteten, dass sie bei Homozygoten dünner waren (vergleiche Fig. 7E und 7F). Alle untersuchten Gelenkknorpel (proximales und distales Femur, Acetabulum, proximaler und distaler Humerus, Fossa glenoidalis, proximale Ulna und proximaler Radius) waren bei den homozygoten Mäusen 1 Monat nach der Geburt im Durchschnitt signifikant dünner (Abb. 10). Es gab weder bei Wildtyp- noch bei homozygoten Mäusen Anzeichen einer signifikanten Erosion der Gelenkoberflächen. Der Gelenkknorpel der homozygoten Mäuse konnte jedoch oft dadurch unterschieden werden, dass sich die Chondrozyten nicht säulenförmig ausrichten ( 7E , F). Außerdem hatten Chondrozyten von Homozygoten oft verzerrte Formen. Gelenke wurden bis zu einem Alter von 1 Jahr untersucht, jedoch konnten keine Hinweise auf eine erhöhte Arthrose bei den Homozygoten im Vergleich zum Wildtyp gefunden werden, dies stimmte mit einer früheren Studie überein (Lapveteläinen et al., 2001).

Vergleich der Dicke von Gelenkknorpeln bei 1 Monat alten Mäusen. Alle Gelenkknorpel von homozygoten (-/-) Mäusen waren dünner als für Wildtyp (+/+) Gelenke. Durchschnittliche Dicke ± SD von Gelenkknorpeln an fünf Kniegelenken, zwei Hüftgelenken, fünf Schultergelenken und drei Ellenbogengelenken von vier Paaren von Wildtyp (+/+) und homozygoten (-/-) Mäusen. Die Datenpunkte repräsentieren 14 bis 70 Messungen pro Gelenk, also insgesamt 420. Am Schultergelenk unterschied sich die Knorpeldicke in der Fossa glenoidalis (SG) nicht signifikant und nur auf dem 90%-Niveau (P = 0,10) an der Humerusgelenkfläche (SH). KF, Kniegelenk, Femur HF, Hüftgelenk, Femur HA, Hüftgelenk, Acetabulum SH, Schultergelenk, Humerus SG, Schultergelenk, Fossa glenoidalis EH, Ellenbogengelenk, Humerus EU, Ellenbogengelenk, Ulna ER, Ellenbogengelenk, Radius


Biologische Aspekte von Tissue-Engineered Knorpel

Die regenerative Medizin des Knorpels ist weit fortgeschritten und erreicht das Stadium der klinischen Anwendung. Unter den verschiedenen Techniken wird das Tissue Engineering, das Elemente der Materialwissenschaft einbezieht, ernsthaft untersucht, angetrieben durch einen hohen klinischen Bedarf. Das Knorpelgewebe-Engineering unter Verwendung eines Polylactid-Gerüsts wurde explorativ bei der Behandlung von Lippen-Nasen-Spaltenpatienten eingesetzt und zeigte gute klinische Ergebnisse während der 3-jährigen Beobachtung. Um die Verlässlichkeit dieser Behandlung zu erhöhen, wird jedoch nicht nur die Anhäufung klinischer Beweise zur Sicherheit und Nützlichkeit der Tissue-Engineering-Produkte, sondern auch die Etablierung eines wissenschaftlichen Hintergrunds zu biologischen Mechanismen als wesentlich angesehen. In diesem Beitrag haben wir aktuelle Trends des Knorpel-Tissue-Engineering in der klinischen Praxis besprochen, experimentelle Ergebnisse zu Zell- und Matrixveränderungen während der Knorpelregeneration zusammengefasst und die Bedeutung weiterer Studien zu biologischen Aspekten von Tissue-Engineering Knorpel diskutiert, insbesondere durch die histologischen und die morphologischen Methoden.

Dies ist eine Vorschau von Abonnementinhalten, auf die Sie über Ihre Institution zugreifen können.


Einführung

Unser Verständnis der detaillierten Strukturorganisation biologischen Materials wird seither hauptsächlich durch mikroskopische Techniken bestimmt. Beginnend mit der Lichtmikroskopie im 18. Jahrhundert und gipfelnd in der Entwicklung des Elektronenmikroskops im 20. Jahrhundert entwickelte sich die Histologie selbst mit der Verbesserung der mikroskopischen Techniken. Die Fülle unseres ultrastrukturellen Wissens über Organismen, Gewebe und Zellen stammt heute meist aus verschiedenen elektronenmikroskopischen Ansätzen wie der Transmissions- oder Rasterelektronenmikroskopie.

Seit Einführung der Elektronenmikroskopie (EM) hat sich eine Vielzahl von Probenvorbereitungstechniken zur Gewinnung geeigneter EM-Proben etabliert 1 – 5 . Dennoch sind die gebräuchlichen Protokolle heute noch sehr komplex, verwenden toxische Chemikalien und führen zu Proben, die sich hauptsächlich für die Elektronenmikroskopie eignen, wobei andere Techniken und deren Korrelation mit EM-Daten von vornherein ausgeschlossen sind. Darüber hinaus werden die so wichtigen Immunmarkierungsuntersuchungen durch mehrere Schwierigkeiten behindert, die sich aus der intensiven Probenbehandlung vor der EM-Datenerfassung ergeben, insbesondere durch die Einbettung in Epoxidharze 6 , 7 . Insgesamt leidet EM unter bestimmten kritischen Einschränkungen, die große Hindernisse für eine Vielzahl von Experimenten an biologischen Proben darstellen.

Mit der Einführung der Rasterkraftmikroskopie (AFM) durch Binnig, Quate und Gerber im Jahr 1986 8 wurde ein neuer mikroskopischer Ansatz verfügbar, der einige bemerkenswerte Vorteile gegenüber klassischen ultrastrukturellen Techniken aufweist. Mit AFM war das Anlegen von Vakuum an die Probe, um Bildinformationen zu erzeugen, nicht mehr erforderlich, wodurch es endlich möglich wurde, ultrastrukturelle Daten von biologischem Material unter physiologischen Bedingungen zu gewinnen 9 , 10 . Darüber hinaus wurde der Bedarf an intensiven Probenvorbereitungstechniken im Vergleich zur Transmissionselektronen- oder Rasterelektronenmikroskopie (TEM, SEM) erheblich reduziert. Weitere Vorteile von AFM gegenüber EM sind z.B. die Fähigkeit, Z-Achsen-Daten präzise aufzulösen, sowie die Fähigkeit, durch Kraftspektroskopie auf viskoelastische Eigenschaften einer Probe zuzugreifen.

Neben den genannten Vorteilen von AFM gegenüber EM verursachte eine auffällige Einschränkung in der Vergangenheit noch große Probleme bei der Erfassung ultrastruktureller Daten interner Merkmale biologischer Proben. Als topographisches Verfahren muss AFM direkte Wechselwirkungen zwischen der Messsonde und der interessierenden Struktur herstellen, um bildgebende Informationen zu erzeugen. Einblicke in die innere Morphologie ganzer Organismen, Gewebe und einzelner Zellen durch AFM zu gewinnen, war daher ein häufiges Hindernis unter AFM-Forschern.

Die Überwindung des genannten Problems verspricht Fähigkeiten zur Erfassung ultrastruktureller Daten biologischer Proben durch AFM im Vergleich zu EM, z.B. die Möglichkeit, auf genaue z-Achsen-Daten sowie auf die viskoelastischen Eigenschaften einer bestimmten Probe zuzugreifen, um nur einige zu nennen.

Um die AFM der internen Eigenschaften von biologischem Material zu ermöglichen, wurde ein einfaches und breit anwendbares Polyethylenglykol-Einbettungs-, Ultraschnitt- und Dehydratisierungsprotokoll entwickelt, das in der Lage ist, die interne Morphologie praktisch jedes biologischen Materials durch AFM ultrastrukturell zu charakterisieren. Die in der vorliegenden Studie untersuchten Proben wurden zunächst mit typischen Reagenzien wie Glutaraldehyd oder Paraformaldehyd fixiert. Zweitens wurde eine Probenentwässerung durch die Anwendung einer Wasser/Ethanol-Verdünnungsreihe durchgeführt, gefolgt von einer Infusion von Polyethylenglykol (PEG) als Einbettungsmedium. Nach Blockverfestigung und Ultraschnitt auf einem typischen Ultramikrotom mit Standardglasmessern wurden die erhaltenen Schnitte auf beschichteten Glasobjektträgern immobilisiert und das wasserlösliche Einbettungsmedium durch wiederholte Waschschritte vollständig entfernt. Schließlich wurden die Proben durch eine einfache Luftströmungstechnik entwässert und anschließend durch intermittierende Kontaktmodus-AFM unter Umgebungsbedingungen abgebildet.

Um Wissenschaftler nicht auszuschließen, die keinen Zugang zu modernster AFM-Technologie haben, wurden in den vorgestellten Untersuchungen gezielt gängige AFM-Instrumente (intermittierender Kontaktmodus in Luft) eingesetzt. Die vorliegende Studie zielt darauf ab, die Anwendbarkeit des genannten Protokolls auf ausgewählte repräsentative biologische Proben zu klären, um seine Durchführbarkeit an praktisch jedem Organismus, Gewebe oder Zelle zu beweisen.


Materialen und Methoden

Präparation und Charakterisierung von nativem Knorpelgewebe

Präparation von nativem Knorpelgewebe

Gelenkknorpelgewebe wurde aus den Kniegelenken von 3, 100 und 200 Tage alten Neuseeland-Kaninchen (Zuchtfarm des Sonderausschusses für Versuchstiere der Provinz Sichuan) unmittelbar nach der Euthanasie geschnitten. Knorpelscheiben wurden mit einer Rasierklinge geerntet und mit PBS gewaschen.

Wassergehalt

Um das Nassgewicht (WW) von Knorpelgewebe zu messen, wurde überschüssige Feuchtigkeit von der Gewebeoberfläche zuerst mit Filterpapier entfernt, bevor es auf eine elektronische Waage (ME204) gelegt wurde, um das WW aufzuzeichnen. Das gleiche Knorpelgewebe wurde dann 72 h bei 70 °C entwässert und das Trockengewicht entsprechend gemessen. Der Wassergehalt von nativem Knorpelgewebe von neugeborenen, juvenilen oder erwachsenen Kaninchen wurde berechnet als (WW – Trockengewicht)/WW *100%.

Mechanische Bewertung

Die mechanische Bewertung jeder Probe wurde unter Verwendung eines Nanoindenters (Piuma, Optics11, Niederlande) bestimmt. Der effektive Elastizitätsmodul wurde durch Datenanpassung der folgenden Parameter berechnet: Sondensteifigkeit 4,3 (N m –1 ) Spitzenradius 51,0 μm.

Quantifizierung von DNA

Die Quantifizierung der DNA wurde mit dem Quant-iT TM Picogreen TM dsDNA-Testkit durchgeführt. Kurz gesagt wurden Knorpelpartikel in der Papainlösung (0,1 mg/ml) bei 65 °C für 24 Stunden vor den Tests verdaut. 100 µl des Papain-Verdauungssaftes wurden mit TE (1x) verdünnt und dann mit Picogreen-Arbeitsflüssigkeit vermischt. Nach einer Inkubation im Dunkeln für 3–5 min wurde die Mischung durch Fluorometrie gemäß dem Protokoll des Herstellers gemessen.

Quantifizierung von sGAG und Gesamtkollagen

Der sGAG-Gehalt wurde mit dem Blyscan GAG Assay-Kit (Biocolor, Newtownabbey, UK) bestimmt. Kurz gesagt wurden 10 &mgr;l des Überstands mit Blyscan-Farbstoffreagenz gemischt. Nach der Zentrifugation wurde der sGAG-Farbstoff-Komplex im Dissoziationsreagenz gelöst, gefolgt von der Messung der Extinktion bei 656 nm mit einem Thermo-Reader (Multiskan FC). Der Gesamtkollagengehalt wurde mit dem Woessner Hydroxyprolin Assay [ 20] gemessen. Der Gehalt an Hydroxyprolin wurde kolorimetrisch bestimmt, und die Umwandlung von Gesamt-Hydroxyprolin in Kollagen erfolgte mit einem Multiplikationsfaktor von 8,2 [ 21].

Präparation und Charakterisierung dezellularisierter Knorpelpartikel

Herstellung dezellularisierter Knorpelpartikel

Das native Knorpelgewebe wurde mit einer Rasierklinge in kleine Stücke geschnitten, bevor es unter Verwendung eines kryogenen Mahlwerks (Scientz-48L) weiter in kleine Partikel gemahlen wurde. Das Dezellularisierungsverfahren wurde von unserer vorherigen Methode übernommen [ 22]. Kurz gesagt, Knorpelpartikel wurden zuerst dreimal mit hypertoner Lösung (50 mM Tris-HCl-Puffer und 1 M NaCl, PH = 8) und hypotoner Lösung (0,5 M Tris-HCl-Puffer, PH = 8) gewaschen. Anschließend wurden die Partikel in flüssigem Stickstoff eingefroren und dreimal in einem 37 °C warmen Ofen aufgetaut. Die Partikel wurden dann mit der 0,5%igen Triton X-100-Lösung 40 min lang unter konstantem Rühren zugegeben, um die Zellmembranen zu zerstören, und dreimal mit Wasser gewaschen. Um die DNA weiter zu eliminieren, wurden 200 U ml –1 DNAse I-Arbeitslösung zugegeben und 12 h bei 37 °C inkubiert. Schließlich wurden die Partikel 20 min in 50 mM Ethylendiamintetraessigsäure (EDTA)-Lösung eingetaucht und dreimal mit Wasser gewaschen. Die dezellularisierten Knorpelpartikel (DCPs) wurden in flüssigem Stickstoff eingefroren und vor der Verwendung in einem Gefrierschrank bei –20°C gelagert.

Entfernung von DNA

Die mit 4',6-Diamidino-2-phenylindol (DAPI) gefärbten Knorpelpartikel von nativen und dezellularisierten Proben wurden verglichen, um die Entfernung von Zellen zu bestätigen. Um die Wirksamkeit der DNA-Entfernung weiter zu validieren, wurde der DNA-Gehalt jeder Probe mit dem Quant-iT TM Picogreen TM dsDNA-Assay quantifiziert, wie im Abschnitt „DNA-Quantifizierung“ beschrieben.

Größenverteilung von DCPs

Nach der Dezellularisierung wurden die DCPs von neugeborenen, juvenilen oder erwachsenen Kaninchen beobachtet und durch Rasterelektronenmikroskopie (REM) unter Mikroskop mit geringer Leistung fotografiert. Die Partikelgröße jeder Probe wurde berechnet und die Verteilungen der DCP-Größe wurden durch die ImageJ-Software analysiert.

Charakterisierung von DCPs

Um den Einfluss des Dezellularisierungsverfahrens auf die verschiedenen DCPs weiter zu charakterisieren, wurden sGAG und Gesamtkollagen mit dem Blyscan GAG Assay bzw. dem Woessner Hydroxyprolin Assay gemessen, wie im Abschnitt „Quantifizierung von SGAG und Gesamtkollagen“ beschrieben.

Herstellung und Charakterisierung von Kollagen-DCP-Komposit-Hydrogelen

Herstellung von Kollagen-DCP-Komposit-Hydrogelen

Kollagen-I-Hydrogel-Lösung, die in unserem Labor unter sterilen Bedingungen aus Kalbshaut extrahiert und gereinigt wurde [ 23] wurde mit 1 M NaOH-Lösung neutralisiert, bevor sie mit DCPs gemischt wurde, die durch 60 Co -Bestrahlung (bei 25 kGy) sterilisiert wurden. Die Endkonzentration an Kollagen betrug 10 mg ml -1 und DCPs in der Mischlösung betrugen 20 mg ml -1, und die Lösung wurde bei 37 °C in eine Form gegossen, um ein Kollagen-DCP-Komposit-Hydrogel (Φ 8 mm × h 2,5mm).

Mikrostrukturanalyse

Kollagen-DCP-Komposit-Hydrogele wurden mit Gradienten-Ethanol entwässert. Die Mikrostrukturen verschiedener Kollagen-DCP-Komposit-Hydrogele von neugeborenen, juvenilen oder erwachsenen Kaninchen wurden unter einem Feldemissions-REM (Hitachi S-4800, Japan) beobachtet. Als Kontrolle dienten Kollagenhydrogele mit gleicher Abmessung und Kollagenkonzentration.

Mechanische Prüfung

Der Speicher- und Verlustmodul des Kollagen-Hydrogels und dreier verschiedener Kollagen-DCP-Komposit-Hydrogele (Φ 8 mm × h 2,5 mm) wurden mit einem dynamisch-mechanischen Analysator (DMA, TA-Q800, USA) bei Raumtemperatur bestimmt und seine mechanischen Eigenschaften wurden gemessen im Mehrfrequenzmodus (1–5 Hz).

Abbaubarkeit

Der Abbau von Kollagen-Hydrogel und drei verschiedenen Kollagen-DCP-Komposit-Hydrogelen (Φ 8 mm × h 2,5 mm) wurde in der Lösung von Kollagenase Typ I (Sigma) mit 30 µg ml -1 bei 37°C zu verschiedenen Zeitpunkten bestimmt. Das WW jeder Probe wurde zu Anfangszeitpunkten (WW0) aufgezeichnet, und die Abbaurate zu verschiedenen Zeitpunkten wurde als (WW0 – WWT)/WW0 × 100 % berechnet, wobei WWT das WW der Probe zu verschiedenen Zeitpunkten war .

Chondrogene Differenzierung von BMSCs im Kollagen-DCP-Komposit-Hydrogel in vitro

Isolierung und Kultur von BMSCs

Kurz gesagt, wurden unter sterilen Bedingungen lange Knochen von getöteten neugeborenen weißen Neuseeland-Kaninchen geerntet. Knochenmark wurde unter Verwendung einer Spritze mit a-MEM (Gibco) ausgespült, die 20 % fötales Rinderserum (FBS) und 1 % Penicillin-Streptomycin enthielt. The cell suspension was filtered through the cell strainer (BD) to remove tissue fragments, followed by centrifugation. The isolated cells were resuspended and cultured in 10-cm cell culture dishes and cultured in a-MEM containing 20% FBS and 1% penicillin-streptomycin. After 24 h, non-adherent cells were washed away, and the attached cells were cultured until reaching 90% confluence. The BMSCs were passaged and cultured in a-MEM containing 10% FBS and 1% penicillin-streptomycin until the third passage (P3) before used in further experiments.

Encapsulation of BMSCs in collagen and collagen-DCP composite hydrogels

Collagen I hydrogel solution was neutralized by 1 M NaOH solution before mixing with DCPs from newborn, juvenile or adult rabbits. The mixture of the collagen-DCP solution was then mixed with BMSCs (P3) to reach a final collagen concentration of 10 mg ml −1 and DCP concentration of 20 mg ml −1 , with the cell density of 3 × 10 6 ml −1 . The mixture solution was then casted in a mould at 37°C to form a collagen-DCP composite hydrogel (Φ 8 mm × h 2.5 mm). Collagen hydrogels with the same BMSCs density, collagen concentration, and hydrogel dimension were also fabricated for comparison. The hydrogels were subsequently cultured in an ultra-low adhesion surface plate. The culture medium was prepared with 1% penicillin-streptomycin, 90 μg/ml VC, 0.35 mM L-proline, 1% ITS, 1% non-essential amino acids and 1% FBS with medium changing interval of 2 days.

Gross appearance and cell viability

The gross appearance of each sample was observed at Days 1, 3, 7, 14 and 21. The diameter of samples at different time points was recorded and compared. Fluorescein Diacetate (FDA)/ Propidium Iodide (PI) double staining was utilized for cell viability measurement at Day 3, 7 and 14. In brief, samples were gently rinsed in PBS for 5 min and incubated in dark for 5 min with the FDA-PI (1 μg ml −1 ) dye solution. Each sample was observed and photographed under a confocal laser scanning microscope (CLSM, Zeiss-LSM880).

Quantitation of DNA and sGAG

To determine the cell proliferation and sGAG secretion, samples were collected and lyophilized for 48 h in a freeze dryer. The dry weight was measured before digested in a papain solution. The cell proliferation (DNA content at different time points) and the sGAG quantity was analyzed using the Quant-iT TM picogreen TM dsDNA assay and the Blyscan GAG assay, which were previously described in Sections ‘Quantitation of DNA’ and ‘Quantitation of SGAG and total collagen’.

Histological and immunohistochemical staining

The BMSCs/hydrogel samples were collected at Days 1, 7, 14 and 21 and fixed with 4% paraformaldehyde. The fixed samples were dehydrated by a gradient of 15% and 30% sucrose. The sample was embedded in the optimal cutting temperature embedding agent and then sectioned (6 μm) in a frozen section machine (Leica, RM2016). The cell and tissue morphology in each sample were observed by Haematoxylin–Eosin (HE) staining, secretion of GAGs was detected by Toluidine blue (TB) staining, and calcium deposition was highlighted with the Alizarin red staining (ARS). Furthermore, immunohistochemical (IHC) of collagen Type II (COL2A1) was performed with the mouse monoclonal Collagen II antibody (1:200, Novus Biologicals, NB600-844) primary antibody and the goat anti-mouse IgG (H + L) HRP (1:200, Affinity, S0002) was the secondary antibody for COLII. In brief, the sections were blocked with goat serum for 2 h to block the non-specific antigen, before incubated with the primary antibodies at 4°C for 10 h. After washed three times with TBS, the sections were immersed with 0.3% H2Ö2 for 10 min to deplete endogenous peroxidase, followed by incubation with the secondary antibody for 20 min. The sections were coloured with diamino-benzidine staining solution and re-dyed with haematoxylin. The sections were dehydrated by gradient ethanol and treated with xylene solution. Finally, the sections were sealed with neutral gum and observed under a light microscope (LEICA DM1000).

Cartilage formation of BMSCs in the collagen-DCP composite hydrogel in vivo

Subcutaneous implantation in nude mice

BMSCs in collagen and collagen-DCP composite hydrogel (Φ 8 mm × h 2.5 mm) were prepared as described in Section ‘Encapsulation of BMSCs in collagen and collagen-DCP composite hydrogels’, and pre-cultured in vitro für 3 Tage. Subcutaneous implantation in nude mice experiments strictly abided by the rules and regulations of the Sichuan University Ethics Committee. In brief, 24 male BALB/c nude mice (6 weeks old) were purchased from GemPharmatech Co. Ltd. After intraperitoneal injection with 10 mg ml −1 pentobarbital sodium, nude mice in anaesthesia condition were placed on an ultra-clean table covered with sterile sheets. The back skin of a nude mouse was disinfected with povidone–iodine, and ophthalmological scissors were used to cut a ∼1.5 cm incision on the back of a nude mouse. Four pre-cultured BMSCs/hydrogel constructs were implanted into two subcutaneous pockets before the skin incision was closed with 4-0 needle suture and disinfected with povidone–iodine. Finally, the nude mice were sent back to their original cages, before euthanasia at day 14 and 28. The implants were collected at each time points for further investigation.

Biochemical analysis

The gross appearance of each implant was observed before (Day 0), and 14/28 days after implantation. The diameter of samples at different time points were recorded and compared. The DNA and sGAG quantity in each sample were analyzed before (Day 0) and 14/28 days after the implantation using the Quant-iT TM picogreen TM dsDNA and Blyscan GAG assays that described in Sections ‘Quantitation of DNA’ and ‘Quantitation of sGAG and total collagen’. Histological staining of HE, TB and ARS, and the IHC staining of COL2 were performed on each implant at Days 0, 14 and 28. The detailed methodologies were described in Section ‘Histological and immunohistochemical staining’.

Gene expression analysis

The mRNA expression levels of four chondrogenic genes (Aggrecan, COL2A1, SOX9 and collagen Type X [COL10A1]) in each implanted construct were analyzed at Days 14 and 28 using Quantitative Real-time PCR (qRT-PCR) technique. In brief, samples were washed with PBS and grinded in an enzyme-free tube with lysate. RNA was extracted using the RNeasy ® Mini Kit (Qiagen) and the RNA concentration was measured using a spectrophotometer (ND1000, Nanodrop Technologies). The isolated RNA was reverse transcribed into cDNA using the iScript TM cDNA Synthesis Kit (BIO-RAD). Finally, the cDNA in RNAse-free water was mixed with Ssofast EvaGreen Supermix (BIO-RAD) and the upstream and downstream primers, and the qRT-PCR was performed using the CFX96 TM qRT-PCR detection system (Bio-Rad, USA). The genes expression was determined by the software of BioRad CFX Manager, which calculated the relative gene expression based on the ΔΔCt method using the housekeeping gene of GAPDH. The forward and reverse primers’ sequences were referred from previous literature [ 24] and summarized in Table 1.

The forward and reverse primer sequences for qRT-PCR

Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC
Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC

The forward and reverse primer sequences for qRT-PCR

Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC
Gene . Forward primer sequences (5′ -3′) . Reverse primer sequences (5′ -3′) .
GAPDH TCGGAGTGAACGGATTTGGC TTCCCGTTCTCAGCCTTGAC
COL2A1 TGATAAGGATGTGTGGAAGCCG CAGGCAGTCCTTGGTGTCTTC
Aggrecan GGCCACTGTTACCGTCACTT GTCCTGAGCGTTGTTGTTGAC
SOX9 TCTGGAGACTGCTGAACGAG CTGCCCATTCTTCACCGACTT
COL10A1 TCCCAGA ACCCAGAATCCATC GGTTGTGGGCCT TTTATGCC

Statistische Analyse

The quantitative data involved in this experiment were presented as mean ± SD. The experimental data were compared by the t-test and the analysis of variance test method using SPSS software. *P < 0.05 was considered to have a significant difference, **P < 0,01 und ***P < 0.001 were considered to be a higher level of significant difference.


Abschluss

This study established a new concept for cartilage regeneration𠅊nalogous to steel-reinforced concrete�sed on ECG and DBM and demonstrated its feasibility. Additionally, the formation method and relative parameters were investigated and optimized. However, some important issues, including how to precisely control the shape and realize homogeneity of the whole regenerated cartilage, still need to be investigated. The presented results provide a new cartilage regeneration strategy with potential for future clinical translation.


Hyaline Cartilage in Other Animals

Animals in the class Chondrichthyes have a skeleton composed completely of cartilage. Haie und Strahlen are good examples of this. Cartilage is less dense than bone, yet still provides strength and therefore allows these animals to move quickly through the water without exerting too much effort.

Cartilage is also found in Wirbellosen, wie zum Beispiel horseshoe crabs, Schnecken, und Kopffüßer (predatory mollusks e.g. octopus and squid). The branchial cartilage in the arthropod Atlantic horseshoe crab (Limulus polyphemus), is rich in vacuolated chondrocytes that differs from any other arthropod.

Endosternite cartilage is another type found in this species. It is more fibrous than the hyaline cartilage found in vertebrates. It is found near the ventral nerve cords and gill cartilage tissue.

In dem Tintenfisch (an example of a cephalopod), the cranial cartilage resembles hyaline cartilage and is one of the only hard parts of the octopus body. The growth of this cartilage occurs via cells moving from the outside to the center. In the common cuttlefish (Sepia officianalis), the cartilage is fibrillar collagen. The growth pattern of this cartilage is essentially the same as in vertebrate cartilage.

In gastropods (snails, slugs, or whelks), the odontophore is a cartilage formed feeding structure that provides feeding support. The odontophore is cell-rich cartilage containing myoglobin that is surrounded by a low volume of extracellular matrix and collagen.

Schließlich im feather duster worms (Sabellid polychaetes), cartilage supports their tentacles.


1.9 Osteoarthritis Research

Osteoarthritis in humans has been extensively studied clinically. Since articular cartilage is avascular and aneural, a diagnosis of primary osteoarthritis is not made until a patient experiences pain in the joint, which signals later-stage disease. The main focus for human osteoarthritis research is to find a way to diagnose the disease early and accurately. The best-known human imaging project during the recent years is the Osteoarthritis Initiative (OAI), which is a multi-center observational study of human osteoarthritis sponsored by the National Institutes of Health in the USA. The OAI data are available publically on the internet. Many correlational studies have been published using various parts of the OAI data.

In addition to studies on human osteoarthritis, a large number of different domestic animals have been used in osteoarthritis studies. 206 However, none of the animal models reproduce all the features of human osteoarthritis. 207 A general consensus in the community is that there is no universal animal model to recapitulate the pathogenesis and progression of human osteoarthritis. 206,207 Despite the limitations, animal models are an integral and irreplaceable component of human osteoarthritis research. This is because no disease can be induced ethically in the human the only alternative for the entire biomedical community is to study the cellular and animal models of the human disease, in order to gain better insights that could be used to produce guidelines for human treatment.

1.9.1 In vivo Models of Osteoarthritis

Primary osteoarthritis progresses slowly over several decades. It is the most common form of osteoarthritis and increases in prevalence and severity with the age in both human and non-human animals. 207 Compared to the idiopathic and slow development of primary osteoarthritis, post-traumatic osteoarthritis in animals and humans is known to be induced as a consequence of injury, and often develops quite rapidly. Post-traumatic osteoarthritis can be reproduced by mechanical insult or by surgery. Since articular cartilage has a limited capacity for repair, the physiological response to the resulting tissue damage rarely restores a normal articular surface. Similarly, any changes in the cartilage structure caused by abnormal loading in a stable joint, or even by degradative enzymes in the synovium, can lead to the development of osteoarthritis. The assessment of animal models of osteoarthritis traditionally depends on the histological analysis of articular cartilage. Recent advances have seen the emergence of many other effective analyses, such as biomarkers and imaging, for monitoring the progress of osteoarthritis. 81,154–156,206,208,209

Although there is a perceived advantage in using naturally occurring models of osteoarthritis (z.B. Dunkin–Hartley guinea pigs) with a slower onset and progression similar to human osteoarthritis, 210 many investigators have utilized fast-advancing animal models first reported by Magnuson in 1941. 211 With a division of the medial collateral ligament and the cruciate ligaments in the joint, Magnuson showed osteoarthritis-like changes in articular cartilage. In 1952, Paatsama published a thesis describing the degradation of canine articular cartilage associated with a cranial cruciate ligament rupture. 212 Many studies from the 1970s onwards that used a similar model, or only the transection of the anterior cruciate ligament or a removal of the meniscus (menisectomy) showed reproducible histopathological changes including fibrillated articular surface, depleted proteoglycan content, and cloning of chondrocytes. 206,207,210

In addition to cartilaginous changes, Radin and Rose 191 showed alterations in the sub-chondral bone and the calcified zone of cartilage after application of repetitive sub-impact loads to the patellofemoral joint. Responses to traumatic injury were also studied using a direct impact applied to the patella using a "drop tower" type of apparatus in order to produce high-energy damage similar to that seen in human injuries. Intra-articular injections of many proteolytic enzymes such as trypsin, papain, and collagenase have also been used to trigger model osteoarthritis in mice, rats, and rabbits. However, the mechanisms responsible for cartilage degradation in these models, particularly those in which papain or trypsin was injected, may deviate significantly from those that normally occur in the human disease. Chemically induced osteoarthritis models use intra-articular injection of sodium iodoacetate to study acute cartilage toxicity and degradation and joint pain however, this has many limitations as a model of osteoarthritis. 213 For example, since sodium iodoacetate is a metabolic poison, this model exhibits extensive chondrocyte cell death, unlike naturally occurring osteoarthritis in humans. However, it does provide an in vivo model of rapid cartilage degradation mirroring some of the events observed in vitro in organ culture screening studies. 214

1.9.2 In vitro Models of Cartilage Degeneration

Im Kontrast zu in vivo animal studies concentrating on the outcomes of post-traumatic joints and progression of osteoarthritis, many in vitro models have been used to study the effect of cell death and specific degradative mechanisms in well-defined loading and culture environments. 208,215–220 Many enzymes have been used to induce cartilage degradation in vitro. For example, to investigate the potential use of imaging as a diagnostic tool for osteoarthritis, purified collagenase, trypsin, or chondroitinase ABC 217,218 have been used to digest bovine patellar cartilage in order to generate spatial and temporal changes in the cartilage matrix. Similar changes in structure and collagen network were observed in proteoglycan-depleted tissue and correlated directly with the loss of compressive strength. 215

As an alternative to enzymatic cleavage, many studies have used in vitro explant injury models to study the molecular mechanisms of chondrocyte death and matrix degradation in injured cartilage. The relatively low compressive moduli and the compression-induced stiffening in the superficial zone are closely related to cell death following a blunt impact or repeated mechanical insults. This was well demonstrated in vitro in a study of chondrocyte necrosis, where chondrocyte death occurred only in the superficial zone when two cartilage disks were positioned articular-surface-to-articular-surface and subjected to 1.0 MPa cyclic compression for 24 h, as shown in Figure 1.12. 216 The vulnerability of cells in the superficial zone is a feature often seen in early osteoarthritic cartilage and is significant in the initiation of post-traumatic osteoarthritis.

Some aspects of cartilage repair can also be examined in vitro by osteochondral models, such as defects of different depths created using a dermal biopsy punch and a scalpel. 209 Lin et al. 208 observed progressive changes in cell viability, collagen cleavage, and proteoglycan loss by cyclically loading cartilage explants with 1 and 5 MPa stresses for 24 h. Thibault et al. 221 subjected cartilage explants to high but physiological cyclic load levels and characterized the resulting damage using a sequence of unconfined-compression stress-relaxation tests. These studies indicated that acute injury in articular cartilage can induce an upregulation of reactive oxygen species and pro-inflammatory cytokines. These are important areas of research, since the prevention of cell death and the inhibition of matrix-degrading enzymes in the injured joint are significant for the prevention of posttraumatic osteoarthritis. Zusammen, diese in vitro explant models provide effective systems to study biomechanical and mechanobiological factors involved in initiating cartilage injury biochemical factors associated with cell death and matrix degradation and gene regulation critical for the advance of post-traumatic osteoarthritis.